CYP2A6 allele nomenclature

Allele

Protein

Nucleotide changes

Trivial name

Effect

Enzyme activity

References

cDNA*

*To be considered CYP2A6*1A, the cDNA reference sequence must be changed to 51G.

Gene*

*To be considered CYP2A6*1A, the genomic reference sequence must be changed to 51G.

In vivo

In vitro

CYP2A6*1A

CYP2A6.1

None

None

 

 

Normal

Normal

Yamano et al., 1990

CYP2A6*1B1 (formerly CYP2A6*1B, has also been called CYP2A6*1E)

CYP2A6.1

gene conversion in 3 flanking region

 

 

Incr.?

 

Yamano et al., 1990
Nakajima et al., 2001

Pitarque et al., 2004

CYP2A6*1B2 (has also been called CYP2A6*1B)

CYP2A6.1

gene conversion in the 3' flanking region

-1013A>G; gene conversion in the 3' flanking region

 

 

 

 

Oscarson et al., 1999b
Ariyoshi et al., 2000
Pitarque et al., 2004

CYP2A6*1B3 (formerly CYP2A6*1C)

CYP2A6.1

gene conversion in 3 flanking region

-395G>A; gene conversion in 3 flanking region

 

 

 

 

Kiyotani et al., 2002

CYP2A6*1B4 

CYP2A6.1

gene conversion in 3 flanking region

gene conversion in 3 flanking region, gene conversion at 7073-7082

 

 

 

 

Mwenifumbo et al., 2010

CYP2A6*1B5 Tentative allele

CYP2A6.1

gene conversion in 3 flanking region

-1680A>G; -1579T>C;
-1301A>C;  -1289G>A;
-1013A>G; 1620T>C; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B6 Predicted haplotype/ Tentative allele

CYP2A6.1

gene conversion in 3 flanking region

-1680A>G; -1579T>C;
-1301A>C;  -1289G>A;
-1013A>G; 1620T>C; 6285A>G; 6293T>C; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B7 Predicted haplotype/ Tentative allele

CYP2A6.1

gene conversion in 3 flanking region

-1680A>G; -1579T>C;
-1464A>T; -1301A>C;
-1289G>A; 1620T>C; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B8 Tentative allele

CYP2A6.1

gene conversion in 3 flanking region

-1680A>G; -1579T>C;
-1464A>T; -1301A>C;
-1289G>A; -1013A>G; 1620T>C; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B9 Predicted haplotype/ Tentative allele

CYP2A6.1

gene conversion in 3 flanking region

-1680A>G; -1579T>C;
-1464A>T; -1301A>C;
-1289G>A; -1013A>G; 1620T>C; 6390C>G; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B10 Predicted haplotype/ Tentative allele

CYP2A6.1

gene conversion in 3 flanking region

-1680A>G; -1579T>C;
-1464A>T; -1301A>C;
-1289G>A; -1013A>G; 1620T>C; 6389C>G; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B11 Predicted haplotype/ Tentative allele

CYP2A6.1

gene conversion in 3 flanking region

-1680A>G; -1579T>C;
-1464A>T; -1301A>C;
-1289G>A; -1013A>G; 1620T>C; 5628C>T; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B12 Predicted haplotype/ Tentative allele

CYP2A6.1

51G>A; gene conversion in 3 flanking region

51G>A; gene conversion in 3 flanking region

 

 

 

 

Haberl et al., 2005

CYP2A6*1B13

CYP2A6.1

22C>T; 1545C>G; gene conversion in 3 flanking region

-745A>G; 22C>T; 6691C>G; gene conversion in 3-UTR

 

 

 

 

Nakajima et al., 2006

CYP2A6*1B14

CYP2A6.1

51G>A; gene conversion in 3'-UTR; 1636C>G

51G>A; 338T>C; gene conversion in 3'-UTR; 6782C>G; 6935_6936insCACTT; 7160A>G

 

 

 

 

Mwenifumbo et al., 2007

CYP2A6*1B15

CYP2A6.1

gene conversion in 3'-UTR; 1636C>G

-1301A>C; -1289G>A;
-967A>C; 1381_1382CT>TC; 1471_1476delCTCTCT; 1620T>C; 3225A>G; gene conversion in 3'-UTR; 6782C>G; 6935_6936insCACTT; 6960_6961insGAAAAG; 7160A>G

 

 

 

 

Mwenifumbo et al., 2007

CYP2A6*1B16

CYP2A6.1

22C>T; 1191T>C; gene conversion in 3'-UTR; 1636C>G

-1301A>C; -1289G>A;
-745A>G; 22C>T; 1630T>C; 5684T>C; gene conversion in 3'-UTR; 6782C>G; 6935_6936insCACTT; 6960_6961insGAAAAG; 6989A>G; 7008_7009TC>GCTCTA; 7160A>G

 

 

 

 

Mwenifumbo et al., 2007

CYP2A6*1B17

CYP2A6.1

51G>A; 1005C>T; gene conversion in 3'-UTR

 

51G>A; 1620T>C; 1646C>T; 2296C>T; 2483G>A; 2994T>C; 3788C>T; 4071delA; 4636A>C; 4850C>T; 4977C>T; 5668A; 6143C>A; gene conversion in 3'-UTR; 6782C>G; 6832A>G; 6835C>A; 6935_6936insCACTT; 6960_6961insGAAAAG; 6989A>G; 7160A>G

 

 

 

 

Mwenifumbo et al., 2008

CYP2A6*1C

 

See CYP2A6*1B3

 

 

 

 

 

CYP2A6*1D Predicted haplotype

CYP2A6.1

-1013A>G

 

 

 

 

Pitarque et al., 2004

CYP2A6*1E

 

See CYP2A6*1B1

 

 

 

 

 

CYP2A6*1F

CYP2A6.1

1224C>T

5717C>T

 

 

 

 

Nakajima et al., 2004

CYP2A6*1G

CYP2A6.1

1224C>T

5717C>T; 5825A>G

 

 

 

 

Nakajima et al., 2004

CYP2A6*1H Predicted haplotype

CYP2A6.1

 

-745A>G

 

 

 

Decr.?

von Richter et al., 2004

CYP2A6*1J Predicted haplotype

CYP2A6.1

 

-1013A>G; -745A>G

 

 

 

 

von Richter et al., 2004

CYP2A6*1K

CYP2A6.1

459G>A; 657C>T

-1301A>C; -1289G>A;
-1199_-1198ins316bpAlu; -686A>G; 51G; 431C>T; 1620T>C; 1779G>A; 2483G>A; 2994T>C; 3378C>T; 3904G>A 4074delA; 5668A; 6354T>C; 7160A>G

 

 

 

 

Mwenifumbo et al., 2008

CYP2A6*1L

CYP2A6.1

 

Gene conversion at 7073-7082

 

 

 

 

Mwenifumbo et al., 2010

CYP2A6*1X2A

CYP2A6.1

Breakpoint at intron 8 - 3'-UTR

 

CYP2A6 gene duplication

 

 

Rao et al., 2000
 

CYP2A6*1X2B

CYP2A6.1

Breakpoint at 5.2 - 5.6 kb downstream from stop codon

 

CYP2A6 gene duplication

 

 

Fukami et al., 2007

CYP2A6*2

CYP2A6.2

51G>A; 479T>A

51G>A; 1799T>A

v1

L160H

None

None

Yamano et al., 1990
Hadidi et al., 1997
Oscarson et al., 1998

CYP2A6*3

CYP2A6.3

CYP2A6/CYP2A7 hybrid

v2

 

?

?

Fernandez-Salguero et al., 1995

CYP2A6*4A

 

CYP2A6 deleted

CYP2A6del,
E-type

CYP2A6 deleted

None

 

Oscarson et al., 1999a
Nunoya et al., 1999a
Nunoya et al., 1999b
Ariyoshi et al., 2000

CYP2A6*4B

 

CYP2A6 deleted

 

CYP2A6 deleted

None

 

Nunoya et al., 1998       
Ariyoshi et al., 2002
    
Ariyoshi et al., 2004

CYP2A6*4C

Identical to the CYP2A6*4A  allele (see above)

CYP2A6*4D

 

CYP2A6 deleted

 

CYP2A6 deleted

None

 

Oscarson et al., 1999b

CYP2A6*4E

 

CYP2A6 deleted

 

 

CYP2A6 deleted

 

 

Mwenifumbo et al., 2008

CYP2A6*4F

 

CYP2A6 deleted

 

 

CYP2A6 deleted

 

 

Mwenifumbo et al., 2008

CYP2A6*4G

 

CYP2A6 deleted

 

CYP2A6 deleted

 

 

Mwenifumbo et al., 2010

CYP2A6*4H

 

CYP2A6 deleted

 

CYP2A6 deleted

 

 

Mwenifumbo et al., 2010

CYP2A6*5

CYP2A6.5

1436G>T; gene conversion in the 3 flanking region

6582G>T; gene conversion in the 3 flanking region

 

G479V

None

None

Oscarson et al., 1999b

CYP2A6*6

CYP2A6.6

383G>A

1703G>A

 

R128Q

 

Decr.

Kitagawa et al., 2001

CYP2A6*7

CYP2A6.7

1412T>C; gene conversion in the 3' flanking region 

6558T>C; gene conversion in the 3' flanking region 

 

I471T

(Decr.) 

Decr.

Ariyoshi et al., 2001
Xu et al., 2002

CYP2A6*8

CYP2A6.8

1454G>T; gene conversion in the 3' flanking region 

6600G>T; gene conversion in the 3' flanking region

 

R485L

Normal

 

Ariyoshi et al., 2001
Xu et al., 2002

CYP2A6*9A

CYP2A6.1

 

-1013A>G; -48T>G

 

TATA box

Decr .

Decr.

Pitarque et al., 2001
Yoshida et al., 2003

Kiyotani et al., 2003
von Richter et al., 2004

CYP2A6*9B

CYP2A6.1

1547C>G

-1680A>G: -1301A>C;
-1289G>A; -1013A>G;
-48T>G; 1620T>C; 1836G>T; 6354T>C; 6692C>G

 

TATA box

 

 

Haberl et al., 2005

CYP2A6*10

CYP2A6.10

1412T>C; 1454G>T; gene conversion in the 3' flanking region

6558T>C; 6600G>T; gene conversion in the 3' flanking region

 

I471T; R485L

Decr.

 

Yoshida et al., 2002
Xu et al., 2002

CYP2A6*11

CYP2A6.11

670T>C

3391T>C

 

S224P

Decr.

Decr.

Daigo et al., 2002

CYP2A6*12A

CYP2A6.12

exons 1-2 of CYP2A7 origin; exons 3-9 of CYP2A6 origin

 

10 aa substitutions 

Decr.

Decr.

Oscarson et al., 2002

CYP2A6*12B

CYP2A6.12

exons 1-2 of CYP2A7 origin; exons 3-9 of CYP2A6 origin; 1547C>G

exons 1-2 of CYP2A7 origin; exons 3-9 of CYP2A6 origin; 1620T>C; 3396G>A; 4489C>T; 5163G>A; 5545G>C; 5717C>G; 6692C>G

 

10 aa substitutions 

 

 

Haberl et al., 2005

CYP2A6*12C

CYP2A6.12

exons 1-2 of CYP2A7 origin; exons 3-9 of CYP2A6 origin; 1547C>G

exons 1-2 of CYP2A7 origin; exons 3-9 of CYP2A6 origin; 1620T>C; 1630G>C; 3396G>A; 4489C>T; 5163G>A; 5545G>C; 5717C>G; 6692C>G

 

10 aa substitutions 

 

 

Haberl et al., 2005

CYP2A6*13

CYP2A6.13

13G>A

-48T>G; 13G>A

 

G5R

 

 

Kiyotani et al., 2002

CYP2A6*14

CYP2A6.14

51G>A; 86G>A

51G>A; 86G>A

 

S29N

 

 

Kiyotani et al., 2002

CYP2A6*15

CYP2A6.15

580A>G

-48T>G; 2134A>G

 

K194E

 

 

Kiyotani et al., 2002

CYP2A6*16

CYP2A6.16

607C>A

2161C>A

 

R203S

 

 

Kiyotani et al., 2002

CYP2A6*17

CYP2A6.17

459G>A; 1093G>A; 1224C>T

209C>T; 1779G>A; 4489C>T; 5065G>A; 5163G>A; 5717C>T; 5825A>G

 

V365M

Decr.

Decr.

Fukami et al., 2004

CYP2A6*18A

CYP2A6.18

1175A>T

5668A>T

 

Y392F

 

Decr

Fukami et al., 2005a

CYP2A6*18B

CYP2A6.18

51G>A; 1175A>T; 1191T>C; 1209T>C

51G>A; 5668A>T; 5684T>C; 5702T>C

 

Y392F

 

Decr.

Fukami et al., 2005a

CYP2A6*18C Predicted haplotype

CYP2A6.18

1175A>T; 1546C>G

-1680A>G: -1579T>C;
-1464A>T; -1301A>C;
-1289G>A; -1013A>G; 1620T>C;
5668A>T; 6692C>G

 

Y392F

 

 

Haberl et al., 2005

CYP2A6*19

CYP2A6.19

1175A>T; 1412T>C; gene conversion in the 3' flanking region

5668A>T; 6354T>C: 6558T>C; gene conversion in the 3' flanking region

 

Y392F; I471T

 

Decr.

Fukami et al., 2005a

CYP2A6*20

CYP2A6.20

51G>A; 587_588delAA; 1191T>C; 1546C>G

51G>A; 2141_2142delAA; 2296C>T; 5684T>C; 6692C>G

 

196Frameshift

Decr.

None

Fukami et al., 2005b
Mwenifumbo et al., 2008

CYP2A6*21 Predicted haplotype

CYP2A6.21

51G>A; 1427A>G

51G>A; 6573A>G

 

K476R

Decr.

 

Haberl et al., 2005
Mwenifumbo et al., 2008

CYP2A6*22 Predicted haplotype

CYP2A6.22

51G>A; 474C>G; 478C>A

51G>A; 1794C>G; 1798C>A

 

D158E; L160I

 

 

Haberl et al., 2005

CYP2A6*23

CYP2A6.23

607C>T

2161C>T

 

R203C

Decr.

Decr.

Ho et al., 2008

CYP2A6*24A

CYP2A6.24

312A>G; 328G>C; 1312A>T

-1301A>C; -1289G>A;
-1013A>G; 51G; 578A>G;
594G>C; 720G>A; 1137C>G; 1620T>C; 2483G>A; 3225A>G; 5668A; 6218A>G; 6282A>G; 6293T>C; 6354T>C; 6458A>T; gene conversion in 3'-UTR; 6782C>G; 7160A>G

 

V110L; N438Y

Decr.

 

Mwenifumbo et al., 2008

 

CYP2A6*24B

CYP2A6.24

312A>G; 328G>C; 1312A>T

-1301A>C; -1289G>A;
-1013A>G; 51G; 578A>G;
594G>C; 720G>A; 1137C>G; 1381_1382CT>TC; 1481_1486delCTCTCT; 1620T>C; 2483G>A; 3225A>G; 5668A; 6218A>G; 6282A>G; 6293T>C; 6354T>C; 6458A>T; gene conversion in 3'-UTR; 6782C>G; 7160A>G

 

V110L; N438Y

 

 

Mwenifumbo et al., 2008

 

CYP2A6*25

CYP2A6.25

22C>T; 352T>C; 1440T>C

-1301A>C; -1289G>A;
-745A>G; 22C>T; 51G; 768A>T; 1620T>C;
1672T>C; 2296C>T; 2483G>A; 2605G>A; 2921G>A; 2994T>C; 4636A>C; 5668A; 6586T>C; 6692C>G; 7160A>G

 

F118L

 

 

Mwenifumbo et al., 2008

CYP2A6*26

CYP2A6.26

22C>T; 352T>C; 383G>T; 390C>T; 391T>G; 1440T>C

 

-1301A>C; -1289G>A; -745A>G; 22C>T; 51G; 1165G>A; 1620T>C; 1672T>C; 1703G>T; 1710C>T; 1711T>G; 2296C>T; 2483G>A; 2994T>C; 4071delA; 4636A>C; 5668A; 6115C>T; 6586T>C; 6692C>G; 7160A>G

 

F118L; R128L; S131A

Decr.

Decr.

Mwenifumbo et al., 2008

CYP2A6*27

CYP2A6.27

22C>T; 352T>C; 608_609GC>A; 1440T>C

 

-1301A>C; -1289G>A;
-745A>G; 22C>T; 51G;1620T>C;
1672T>C; 2162_2163GC>A; 2296C>T; 2483G>A; 2994T>C; 3872G>A; 4071delA; 4636A>C; 5668A; 5857T>A; 6586T>C; 6692C>G; 7160A>G

 

F118L; R203Frameshift

 

Decr.

Mwenifumbo et al., 2008

CYP2A6*28A

CYP2A6.28

51G>A; 1245C>T; 1252A>G; 1257G>C

-1269T>C; 51G>A; 656G>T; 1620T>C; 4681T>G; 5668A; 5738C>T; 5745A>G; 5750G>C; 6354T>C; 6361C>A; 6385G>T; 6389C>G; 6390T>C; gene conversion in 3'-UTR; 6782C>G; 7160A>G

 

N418D; E419D

 

 

Mwenifumbo et al., 2008

CYP2A6*28B

CYP2A6.28

51G>A; 1245C>T; 1252A>G; 1257G>C

-1269T>C; 51G>A; 656G>T; 1381_1382CT>TC; 1481_1486delCTCTCT; 1620T>C; 4681T>G; 5668A; 5738C>T; 5745A>G; 5750G>C; 6354T>C; 6361C>A; gene conversion in 3'-UTR; 6960_6961insGAAAAG; 7160A>G

 

N418D; E419D

 

 

Mwenifumbo et al., 2008

CYP2A6*29

 

 

 

 

 

 

 

To be released

CYP2A6*30

 

 

 

 

 

 

 

To be released

CYP2A6*31A

CYP2A6.31

16A>C

-1289G>A; -1013A>G;
-492_-470delCCCCTTCCTGAGACCCTTAACCC
insAATCCATATGTGGAATCTG; 16A>C; 51G; 1339C>G; 1620T>C; 2721G>A; 2994T>C; 3255A>G; 3315C>T; 5668A; 6692C>G; 7160A>G; 7568C>T

 

M6L

 

 

Mwenifumbo et al., 2008

CYP2A6*31B

CYP2A6.31

16A>C; 201C>T

-1289G>A; -1013A>G;
-492_-470delCCCCTTCCTGAGACCCTTAACCC
insAATCCATATGTGGAATCTG; -975T>C; 16A>C; 51G; 467C>T; 1339C>G; 1620T>C; 2721G>A; 2994T>C; 3225A>G; 3315C>T; 4074delA; 5668A; 6692C>G; 7160A>G

 

M6L

 

 

Mwenifumbo et al., 2008

CYP2A6*32

 

 

 

 

 

 

 

To be released

CYP2A6*33

 

 

 

 

 

 

 

To be released

CYP2A6*34

CYP2A6.34

Exons 1-4 of CYP2A7 origin; exons 5-9 of CYP2A6 origin (breakpoint in intron 4)

 

M6L; V13A; K30R; Q53H; M54I; Y55C; N56D; L58I; I61F; R64C; V117A; R128L; S131A; A153S; D158E; L160I; G162S; G164H; K194E; R203S; M204V

 

 

Iulio et al., 2009

CYP2A6*35A

CYP2A6.35

1312A>T

-1301A>C; -1289G>A;
-1013A>G; 720G>A; 1137C>G; 1620T>C; 2483G>A; 3225A>G; 6218A>G; 6282A>G; 6293T>C; 6354T>C;
6458A>T; gene conversion in the 3 flanking region; 6782C>G; 7160A>G

 

N438Y

Decr.

Decr.

Koudsi et al., 2009

CYP2A6*35B

CYP2A6.35

22C>T; 1312A>T

-1301A>C; -1289G>A; -745A>G; 22C>T; 1620T>C; 4084delA; 6458A>T; gene conversion in the 3 flanking region; 6782C>G; 6835C>A; 6999T>C; 7160A>G

 

N438Y

Decr.

Decr.

Koudsi et al., 2009

CYP2A6*36

CYP2A6.36

22C>T; 1312A>T; 1412T>C

-1301A>C; -1289G>A; -745A>G; 22C>T; 1620T>C; 4084delA; 6458A>T; 6558T>C; gene conversion in the 3 flanking region; 6782C>G; 6835C>A; 6999T>C; 7160A>G

 

N438Y; I471T

 

 

Koudsi et al., 2009

CYP2A6*37

CYP2A6.37

22C>T; 1312A>T; 1412T>C; 1454G>T

-1301A>C; -1289G>A; -745A>G; 22C>T; 1620T>C; 4084delA; 6354T>C; 6458A>T; 6558T>C; 6600G>T; gene conversion in the 3 flanking region; 6782C>G; 6835C>A; 6936_6937insCACTT; 6961_6962insGAAAAG; 6989A>G; 6999T>C; 7160A>G

 

N438Y; I471T; R485L

 

 

Koudsi et al., 2009

CYP2A6*38

CYP2A6.38

1051T>C

5023A>G

 

Y351H

 

 

Bloom et al., 2011

CYP2A6*39

CYP2A6.39

171C>A; 202G>A; 459G>A; 1224C>T

171C>A; 468G>A; 1779G>A; 5717C>T

 

V68M

Decr. expr./Decr. activity per pmol

 

Piliguan et al., 2014

CYP2A6*40

CYP2A6.40

144G>A; 447C>G; 771C>T; 1237C>T

144G>A; 1767C>G; 3492C>T; 5738C>T

 

I149M

Decr. expr./Decr. activity per pmol

 

Piliguian et al., 2014

CYP2A6*41

CYP2A6.41

51G>A; 241C>T; 794G>A

 

51G>A; 507C>T; 3515G>A

 

 

R265Q

None

Decr.

Piliguian et al., 2014

CYP2A6*42

CYP2A6.42

51G>A; 803T>C; 1191T>C

 

51G>A; 3524T>C; 5684T>C

 

I268T

Decr. expr./Incr. activity per pmol

 

Piliguian et al., 2014

CYP2A6*43

CYP2A6.43

908C>T

4406C>T

 

 

T303I

Decr. expr./Unchanged activity per pmol

 

Piliguian et al., 2014

CYP2A6*44

CYP2A6.44

51G>A; 1168G>A; 1245C>T; 1252A>G; 1257G>C

51G>A; 5661G>A; 5738C>T; 5745A>G; 5750G>C

 

E390K; N418D; E419D

Decr. expr./Incr. activity per pmol

 

Piliguian et al., 2014

CYP2A6*45

CYP2A6.45

51G>A; 956G>A; 1385T>C

51G>A; 4464G>A; 6531T>C

 

 

L462P

Decr. expr./Decr. activity per pmol

 

Piliguian et al., 2014

Additional SNPs, present in characterized haplotypes

 

 

 

-1890C>T; -1643C>T;
-1569T>C; -1162G>A;
-745A>G; 144G>A; 3492C>T; 3570C>G; 4932C>T; 5684T>C; 5738C>T; 5823C>T; 5843G>C

 

 

 

 

Haberl et al., 2005

Additional SNPs, where the haplotype has not yet been determined

 

 

 

1620T>C; 1836G>T; 1874G>T; 1890G>C; 2026C>T; 3396G>A; 3570C>G; 4489C>T; 4932C>A; 5336G>A; 6282A>G; 6354T>C; 6692C>G; 6832A>G; 6835C>A

 

 

 

 

Kiyotani et al., 2002

 

 

 

209C>T

 

 

 

 

Saito et al., 2003

 

 

 

237G>A; 388C>G; 413T>G; 618delG; 3332G>A; 4350G>A; 4636A>C; 5142C>T; 5437C>T; 5521A>T; 5525G>C; 5545G>C; 5573A>C; 5684T>C; 5717C>T; 6361C>A; 6389C>G; 6681A>G; 6685C>T; 6688A>G; 6690A>G; 6696C>T; 6698T>C; 6699insC; 6703delG; 6706G>A; 6710C>G; 6712A>G; 6713G>T; 6714C>A; 6720C>A; 6726C>G; 6729G>A; 6734G>C; 6735C>G

 

 

 

 

Solus et al., 2004

 

  

 

567C>T

 

R101X

 

 

Haberl et al., 2005

 

   

 

2061T>G

 

D169E

 

 

Haberl et al., 2005

 

   

 

3515G>A

 

R265Q

 

 

Haberl et al., 2005

 

   

 

5661G>A

 

E390K

 

 

Haberl et al., 2005

 

 

 

-1126C>A; 467C>T; 557G>A; 578A>G; 1710C>T; 2035G>T; 2039T>C; 2158T>C; 2274G>C; 3315C>T; 4193G>C; 4561G>A; 5162C>T; 5636A>C; 5660C>T; 5732C>T; 6586T>C

 

 

 

 

Haberl et al., 2005

Changes made since the last update (27-Jan-2012) are marked in red.

Allele frequencies: Mizutani, 2003; Solus et al., 2004

Links to the NCBI dbSNP homepage are available for functional SNPs when present in NCBI's database.

Nucleotide variations in bold are the major SNPs/alterations responsible for the phenotype of the corresponding allele.

OMIM GeneCards

 

 


Home Page Inclusion criteria
CYP1A1 CYP1A2 CYP1B1 CYP2A6 CYP2A13 CYP2B6 CYP2C8 CYP2C9 CYP2C19 CYP2D6 CYP2E1 CYP2F1 CYP2J2
CYP2R1
CYP2S1 CYP2W1 CYP3A4 CYP3A5 CYP3A7 CYP3A43 CYP4A11 CYP4A22 CYP4B1 CYP4F2 CYP5A1 CYP8A1 CYP19A1 CYP21A2 CYP26A1 POR

 This page was updated 21-Jan-2014 by Sarah C Sim
Questions and comments are always welcome