CYP21A2 allele nomenclature

 

Allele 

Nucleotide changes

Effect

Trivial_name 

Clinical phenotype 
(see footnote)

Activity in vitro 
17OHP/prog 

References____________ 

Gene

Numbering starts from A in the initiation codon.

cDNA
Numbering starts from A in the initiation codon.

NORMAL VARIANTS: 

CYP21A2*1A 

None 

None

 

wt

Normal 

 

Higashi et al 1986

CYP21A2*1B 

655C>A 

 

 

wt

Normal 

 

White et al 1986

CYP21A2*2 

27_28insCTG 

27_28insCTG

9_10insL 

 

Normal 

Normal 

Rodrigues et al 1987
Higashi et al 1991 

CYP21A2*3 

683A>G 

305G>A

K102R 

 

Normal 

 

Rodrigues et al 1987

CYP21A2*4 

1121C>G 

549C>G

D183E 

 

Normal

Normal 

Higashi et al 1991

CYP21A2*5 

1645G>C 

793G>C

S268T 

 

Normal 

Normal 

Rodrigues et al 1987
Wu et al 1991
Tusie-Luna et al 1991

CYP21A2*6

2699A>G 

1478G>A

N493S 

 

Normal 

 

Rodrigues et al 1987

GENE DELETION: 

CYP21A2*7 

30 kb deletion including 3' of CYP21A1P and 5' of CYP21A2 

30 kb deletion including 3' of CYP21A1P and 5' of CYP21A2

A single, non-functional gene remains 

CYP21A2 deletion 

SW 

 

White et al 1988

PSEUDOGENE-DERIVED MUTATIONS: 

CYP21A2*8 

89C>T 

89C>T

P30L 

 

NC 

60%/30% 

Tusie-Luna et al 1991

CYP21A2*9 

655A/C>G 

 

New splice acceptor 

I2 splice 

SW 

Weak activity 

Rodrigues et al 1987
Higashi et al 1991

CYP21A2*10 

707_714delGAGACTAC 

329_336delGAGACTAC

G110Frameshift 

Del 8 bp E3 

SW 

 

Higashi et al 1988

CYP21A2*11

999T>A

515T>A

I172N 

 

SV 

<2% 

Amor et al 1988
Tusie-Luna et al 1990 

CYP21A2*12 

1380T>A 

707T>A

I236N 

 

 

1%/2.4%

Higashi et al 1988

Robins et al 2005

CYP21A2*13 

1383T>A

710T>A

V237E 

 

 

0%/0.1%

Higashi et al 1988

Robins et al 2005

CYP21A2*14 

1389T>A 

716T>A

M239K 

 

 

95%/98%

Higashi et al 1988

Robins et al 2005

CYP21A2*15

1683G>T 

841G>T

V281L 

 

NC 

50%/20% 

Speiser et al 1988
Tusie-Luna et al 1990

CYP21A2*16 

1762_1763insT 

920_921insT

L307Frameshift 

 

SW 

 

Higashi et al 1988

CYP21A2*17 

1994C>T

952C>T

Q318Stop 

 

SW 

 

Globerman et al 1988

CYP21A2*18 

2108C>T 

1066C>T

R356W

 

SW 

No activity 

Chiou et al 1990

CYP21A2*19

2578C>T 

1357C>T

P453S 

 

NC 

50-68%/20-46% 

Owerbach et al 1992
Helmberg et al 1992
Nikoshkov et al 1997

COMBINATIONS OF PSEUDOGENE-DERIVED MUTATIONS: 

CYP21A2*20A 

1380T>A; 1383T>A; 1389T>A 

707T>A; 710T>A; 716T>A

I236N; V237E ; M239K

Cluster E6 

SW 

No activity 

Higashi et al 1988

CYP21A2*20B 

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T; 655A/C>G; 706_713delGAGACTAC; exact extension not defined 

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T; 328_335delGAGACTAC; exact extension not defined

CYP21A2 converted to CYP21A1P in the 5' part, extending beyond the 8 bp del in exon 3 

Large gene conversion (5') 

SW 

 

Donohoue et al 1986
White et al 1988
Higashi et al 1988

CYP21A2*20C 

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T; 655A/C>G; 706_713delGAGACTAC; 999T>A; 1380T>A; 1383T>A; 1389T>A; 1683G>T; 1762_1763insT 

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T; 328_335delGAGACTAC; 515T>A; 707T>A; 710T>A; 716T>A; 841G>T; 920_921insT

CYP21A2 converted to CYP21A1P in the 5' part, extending beyond the 8 bp del in exon 3 

Large gene conversion (5') 

SW 

 

Higashi et al 1988

CYP21A2*20D 

-126C>T; -113G>A; -110T>C;

-103A>G 

-126C>T; -113G>A; -110T>C;

-103A>G

Reduced expression 

Promotor conversion 

NC? 
normal

20% gene expression 

Bristow et al 1993
Chang et al 1995

CYP21A2*20E 

655A/C>G; 1683G>T

841G>T

I2 splice; V281L 

 

SW 

 

Wedell et al 1994

CYP21A2*20F

999T>A; 1380T>A; 1383T>A; 1389T>A; 1683G>T; 1762_1763insT 

515T>A; 707T>A; 710T>A; 716T>A; 841G>T; 920_921insT

I172N ; I236N; V237E ; M239K; V281L; L307Frameshift 

 

SW 

 

Wedell et al 1994

CYP21A2*20G 

1380T>A; 1383T>A; 1389T>A; 1683G>T

707T>A; 710T>A; 716T>A; 841G>T

I236N; V237E ; M239K; V281L

 

SW 

 

Wedell et al 1994

CYP21A2*20H 

1762_1763insT ; 1994C>T

920_921insT; 952C>T

L307Frameshift; Q318Stop

 

SW 

 

Wedell et al 1994

CYP21A2*20J

1994C>T; 2108C>T 

952C>T; 1066C>T

Q318Stop; R356W

 

SW 

 

Wedell et al 1994

CYP21A2*20K 

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T; 655A/C>G;
706_713delGAGACTAC

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T; 328_335delGAGACTAC

CYP21A2 converted to CYP21A1P in the 5' part, extending beyond the 8 bp del in exon 3

Large gene conversion (5') 

SW 

 

Levo et al 1997

CYP21A2*20L 

999T>A; 1380T>A; 1383T>A; 1389T>A; 1683G>T; 1762_1763insT ;
1994C>T; 2108C>T

515T>A; 707T>A; 710T>A; 716T>A; 841G>T; 920_921insT; 952C>T; 1066C>T

I172N ; I236N; V237E ; M239K; V281L; L307Frameshift; Q318Stop; R356W

Large gene conversion (3') 

SW 

 

Levo et al 1997

CYP21A2*20M 

999T>A; 2578C>T 

515T>A; 1357C>T

I172N; P453S 

 

SV 

 

Levo et al 1997

CYP21A2*20N 

655A/C>G; 999T>A

515T>A

I2 splice; I172N  

 

SW 

 

Wedell 1998

CYP21A2*20P 

1683G>T; 1762_1763insT 

841G>T; 920_921insT

V281L; L307Frameshift 

 

SW 

 

Wedell 1998

CYP21A2*20Q 

1683G>T; 1994C>T; 2108C>T

841G>T; 952C>T; 1066C>T

V281L; Q318Stop; R356W

 

SW 

 

Ohlsson et al 1999

CYP21A2*20R

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T

Promotor conversion; P30L

 

NC-SV

 

L'Allemand et al 2000

CYP21A2*20S

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T; 655A/C>G

-126C>T; -113G>A; -110T>C;

-103A>G; 89C>T

Promotor conversion; P30L; I2 splice

 

SW

 

Dolzan et al 2003

CYP21A2*20T

655A/C>G; 1380T>A; 1383T>A; 1389T>A; 1683G>T; 1994C>T

707T>A; 710T>A; 716T>A; 841G>T; 952C>T

I2 splice; I236N; V237E ; M239K; V281L; Q318Stop

 

SW

 

Dolzan et al 2003

CYP21A2*20U

1683G>T; 1762_1763insT ; 1994C>T; 2108C>T

841G>T; 920_921insT; 952C>T; 1066C>T

V281L; L307Frameshift; Q318Stop; R356W

 

SW

 

Koppens et al 2000
Stikkelbroeck et al 2003

CYP21A2*20V

1380T>A; 1383T>A; 1389T>A; 1683G>T; 1762_1763insT ; 1994C>T; 2108C>T

707T>A; 710T>A; 716T>A; 841G>T; 920_921insT; 952C>T; 1066C>T

I236N; V237E ; M239K; V281L; L307Frameshift; Q318Stop; R356W

  

SW

 

Kharrat et al 2004

CYP21A2*9 + CYP21A2*17 

655A/C>G; 1994C>T 

952C>T

I2 splice; Q318Stop 

 

SW 

 

Wedell et al 1994

RARE MUTATIONS AND COMBINATIONS: 

CYP21A2*21 

1203G>C

631G>C

V211L 

 

normal

 

Speiser et al 1988

CYP21A2*22 

692C>T; 2578C>T 

314C>T; 1357C>T

P105L; P453S 

 

NC 

10%/7% 

Wedell et al 1992
Nikoshkov et al 1997

CYP21A2*23 

1713G>A 

871G>A

G291S 

 

SW 

0.8%/0.8% 

Wedell et al 1992 
Nikoshkov et al 1998 

CYP21A2*24 

2058G>A; 2578C>T

1016G>A; 1357C>T

R339H; P453S 

 

NC 

 

Helmberg et al 1992 

CYP21A2*25

2668_2669delGGinsC 

1447_1448delGGinsC

R483Frameshift 

 

SW 

 

Wedell et al 1992

CYP21A2*26

1779G>C

 

Disrupted splice donor intron 7 

 

SW 

 

Wedell et al 1993

CYP21A2*27

2339G>A 

1214G>A

W405X 

 

SW 

 

Wedell et al 1993

CYP21A2*28 

2669G>C 

1448G>C

R483P 

 

 

1.0/2.2% 

Wedell et al 1993
Nikoshkov et al 1998

CYP21A2*29

2063C>T 

1021C>T

R341W 

 

 

 

Gunn et al 1993 

CYP21A2*30

66G>A 

66G>A

W22X

 

SW 

 

Lajic et al 1996

CYP21A2*31

295A>G 

 

Disruption splice acceptor intron 1 

 

SW 

 

Lajic et al 1996

CYP21A2*32

1748G>A 

906G>A

W302X

 

SW 

 

Levo et al 1997

CYP21A2*33 

2109G>C

1067G>C

R356P 

 

SW 

0.15/0.15% 

Lajic et al 1997

CYP21A2*34

2109G>A 

1067G>A

R356Q 

 

SV 

0.65%/1.1% 

Lajic et al 1997

CYP21A2*35

2265G>C 

1140G>C

E380D 

 

SW? 

30% 

Kirby-Keyser et al 1997
Hsu et al 1999

CYP21A2*36 

669C>A

291C>A

Y97X

 

SW 

 

Krone et al 1998

CYP21A2*37 

989_990delTGinsA 

505_506delTGinsA

C169Frameshift 

 

SW 

 

Witchel et al 1999

CYP21A2*38

1159_1161delAGG

587_589delAGG

E196del 

 

 

6%/23% 

Nikoshkov et al 1998

CYP21A2*39

387G>A 

 

Disrupted splice donor intron 2 

 

SW 

 

Lee et al 1998

CYP21A2*40

1988C>T 

946C>T

R316X

 

SW 

 

Lee et al 1998

CYP21A2*41

2030_2039delTCCAGCTCCC 

988_997delTCCAGCTCCC

S330Frameshift 

Del 10 bp E8 

SW 

 

Lee et al 1998

CYP21A2*42

2316_2331dupCCTGGATGAGACGGTC

1175_1190dupCCTGGATGAGACGGTC

V397Frameshift 

Dupl 16 bp E9 

SW 

 

Lee et al 1998

CYP21A2*43

1780T>G 

 

Disrupted splice donor intron 7 

 

SW 

 

Ordonez-Sánchez et al 1998

CYP21A2*44

2647delT 

1426delT

P475Frameshift 

 

 

 

Ordonez-Sánchez et al 1998

CYP21A2*45

89C>A 

89C>A

P30Q 

 

SW 

0.2%/0% 

Lajic et al 1999

CYP21A2*46

141delT 

141delT

L48Frameshift 

 

SW 

 

Krone et al 1999

CYP21A2*47 

191G>A 

191G>A

G64E 

 

SW 

No activity 

Ohlsson et al 1999

CYP21A2*48 

1626C>T 

784C>T

Q262X 

 

SW 

 

Ohlsson et al 1999

CYP21A2*49 

2127C>T 

1185C>T

A362V 

 

SW 

No activity 

Ohlsson et al 1999

CYP21A2*50 

317A>T 

220A>T

K74X 

 

SW 

 

Nunez et al 1999

CYP21A2*51

366G>T 

268G>T

G90V 

 

SW 

No activity 

Lobato et al 1999
Nunez et al 1999

CYP21A2*52 

1016G>C 

533G>C

G178A 

 

 

19%/0% 

Lobato et al 1999
Nunez et al 1999

CYP21A2*53

1713G>T

871G>T

G291C 

 

SW 

No activity 

Lobato et al 1999
Nunez et al 1999

CYP21A2*54 

2103G>A 

1061G>A

R354H 

 

SW 

No activity 

Lobato et al 1999
Nunez et al 1999

CYP21A2*55 

2494G>A 

1270G>A

G424S 

 

SV 

1.6%/2% 

Billerbeck et al 1999
Tardy et al 2010

CYP21A2*56 

655A/C>G; 2494G>A

1270G>A

I2 splice; G424S 

 

 

 

Billerbeck et al 1999

CYP21A2*57 

1684T>G 

842T>G

V281G 

 

SV 

3.9%/3.9% 

Krone et al 2000
Lajic et al 2001

CYP21A2*58 

1740C>T 

898C>T

L300F 

 

SV 

 9.5%/4.4%

Krone et al 2000
Lajic et al 2001

CYP21A2*59

2102C>T

1060C>T

R354C 

 

SW 

 

Krone et al 2000

CYP21A2*60

 996T>A

512T>A

 I171N

 

 

0.7%/0.6% 

Balsamo et al 2000
Barbaro et al 2006

CYP21A2*61

2665C>T

1444C>T

P482S

 

 NC

 70%/72%

Balsamo et al 2000

Barbaro et al 2004

CYP21A2*62

82_83insC

82_83insC

H28Frameshift

 

SW

 

Lau et al 2001

CYP21A2*63

62_172dup111

62_172dup111

21_57dup37

Dup 111bp Ex 1

SV

 

Loke et al 2001

CYP21A2*64

1624T>C

782T>C

L261P

 

SW

 

Loke et al 2001

CYP21A2*65

1981C>A

949C>A

L317M

 

NC

 

Deneux et al 2001

CYP21A2*66

2130T>G

1088T>G

L363W

 

SV

 

Levo et al 2001

CYP21A2*67

2524C>T

1303C>T

R435C

 

NC

 

Deneux et al 2001

CYP21A2*68

666A>G

 

Disrupted splice acceptor intron 2

 

SW

 

Billerbeck et al 2002

CYP21A2*69

992_993insA

508_509insA

S170Frameshift

 

SW

 

Billerbeck et al 2002

CYP21A2*70

1579delA

737delA

E246Frameshift

 

SW

 

Koyama et al 2002

CYP21A2*71

1752G>A

910G>A

V304M

 

NC

46%/26%

Lajic et al 2002

CYP21A2*72

2248G>A

1123G>A

G375S

 

SW

<1%/<1%

Lajic et al 2002

CYP21A2*73

2453C>T

1222C>T

R408C

 

SW

1.3%/0.6%

Billerbeck et al 2002
Soardi et al 2008

CYP21A2*74

-126C>T; -113G>A; -110T>C;

-103A>G; 43G>A; 89C>T

-126C>T; -113G>A; -110T>C;

-103A>G; 43G>A; 89C>T

Promotor conversion; A15T; P30L

 

SV

 

Dolzan et al 2003

CYP21A2*75

89C>T; 185A>T

89C>T; 185A>T

P30L; H62L

 

NC

 

Pinto et al 2003

CYP21A2*76

1121delC

549delC

D183Frameshift

 

SW

 

Stikkelbroeck et al 2003

CYP21A2*77

1713G>C

871G>C

G291R

 

 

 

Stikkelbroeck et al 2003

CYP21A2*78

1744C>A

902C>A

S301Y

 

NC

 

Stikkelbroeck et al 2003

CYP21A2*79

2064G>C

1022G>C

R341P

 

NC/SV

0.7%/0.7%

Pinto et al 2003
Barbaro et al 2006

CYP21A2*80

2253C>A

1128C>A

Y376X

 

SW

 

Stikkelbroeck et al 2003

CYP21A2*81

2669G>A

1448G>A

R483Q

 

NC

1.1%/3.8%

Stikkelbroeck et al 2003
Robins et al 2006

CYP21A2*82

2498G>A

1277G>A

R426H

 

SV-SW

0.5%/0.4%

Baumgartner-Parzer et al 2001
Barbaro et al 2006

CYP21A2*83

3G>A

3G>A

M1I

 

SW

 

Usui et al 2003

CYP21A2*84

749G>A

371G>A

R124H

 

NC

 

Usui et al 2003

CYP21A2*85

56G>A

56G>A

W19X

 

SW

 

Kharrat et al 2004

CYP21A2*86

2668_2669insC

1447_1448insC

R483Frameshift

 

SW

 

Kharrat et al 2004

CYP21A2*87

2668C>T

1447C>T

R483W

 

SW

 

Kharrat et al 2004

CYP21A2*88

1208_1209insT

636_637insT

P213Frameshift

 

SW

 

Usui et al 2004

CYP21A2*89

64_65insT

64_65insT

W22Frameshift

 

SW

 

Ezquieta et al 1999

CYP21A2*90

1355C>T

682C>T

Q228X

 

SW

 

Ezquieta et al 2002a

CYP21A2*91

185A>T

185A>T

H62L

 

NC

 44.5%/20.7%

Ezquieta et al 2002b
Soardi et al 2008

CYP21A2*92

1689A>C

847A>C

M283L

 

NC

 

Ezquieta et al 2002b

CYP21A2*93

 

 

 

 

 

 

Withdrawn

CYP21A2*94

327T>C

230T>C

I77T

 

SV

3%/5%

Krone et al 2005a

CYP21A2*95

2522C>T

1301C>T

A434V

 

SV

14%/12%

Krone et al 2005a

CYP21A2*96

2093G>A

1051G>A

E351K

 

SV

1.1%/1.2%

Krone et al 2005b

CYP21A2*97

126_127delC

126_127delC

P42Frameshift

 

 

 

Zeng et al 2004

CYP21A2*98

992_993insA

508_509insA

S170Frameshift

 

 

 

Zeng et al 2004

CYP21A2*99

2135C>T

1093C>T

H365Y

 

 

 

Zeng et al 2004

CYP21A2*100

2657G>T

1436G>T

R479L

 

 

76%/80%

Zeng et al 2004
Robins et al 2006

CYP21A2*101

1762_1763insT 

920_921insT

L307Frameshift

 

SW

 

Ezquieta et al 2002a

CYP21A2*102

81_93delCACCTCCCGCCTC

81_93delCACCTCCCGCCTC

H28Frameshift

 

SW

 

Kharrat et al 2005

CYP21A2*103

2663C>T; 2665C>T

1442A>C; 1444C>T

Q481P; P482S

 

SW

 

Di Pasquale et al 2005

CYP21A2*104

1985C>T

943C>T

Q315X

 

 

 

Dolzan et al 2005

CYP21A2*105

1380T>A; 1383T>A; 1389T>A; 2551C>T

707T>A; 710T>A; 716T>A; 1330C>T

I236N; V237E; M239K; R444X

Cluster E6; R444X

SW

 

Friaes et al 2006

CYP21A2*106

2558T>C

1337T>C

L446P

 

SV-SW

0.5%/0.0%

Barbaro et al 2006

CYP21A2*107

989T>C

505T>C

C169R

 

SV

0.1/%0%

Grischuk et al 2006

CYP21A2*108

1016G>A

532G>A

G178R

 

 

0.4%/0%

Grischuk et al 2006

CYP21A2*109

1746T>C

904T>C

W302R

 

SW

0.1%/0%

Grischuk et al 2006

CYP21A2*110

2497C>T

1276C>T

R426C

 

 

0%/0%

Grischuk et al 2006

CYP21A2*111

794T>A

416T>A

V139E

 

SW

 

Robins et al 2006

CYP21A2*112

817T>C

439T>C

C147R

 

NC/SV

 

Robins et al 2006

CYP21A2*113

1380A>G

697A>G

R233G

 

NC

 

Robins et al 2006

CYP21A2*114

1726C>A

884C>A

T295N

 

SV/SW

 

Robins et al 2006

CYP21A2*115

1764C>T

922C>T

L308F

 

SV

 

Robins et al 2006

CYP21A2*116

2138C>T

1096C>T

R366C

 

 

 

Robins et al 2006

CYP21A2*117

2640G>T

1419G>T

M473I

 

N/NC

 

Robins et al 2006

CYP21A2*118

981T>C

497T>C

L166P

 

 

0.3%/0.4%

Robins et al 2006

CYP21A2*119

2296G>A

1171G>A

A391T

 

 

38%/23%

Robins et al 2006

CYP21A2*120

1683G>C

841G>C

V281L

 

 

 

Barbat et al 1995

CYP21A2*121

1762delT

920delT

L307frameshift

 

 

 

Ezquieta et al 2002

CYP21A2*122

1981C>G

949C>G

L317V

 

NC

 

Bojunga et al 2005

CYP21A2*123

82_94delCACCTCCCGCCTC

82_94delCACCTCCCGCCTC

H28frameshift

del 13 bp E1

SW

 

Kharrat et al 2005

CYP21A2*124

2050C>G

1008C>G

Y336X

 

 

 

Bernal González et al 2006

CYP21A2*125

2452G>A

1291G>A

E431K

 

 

 

Dain et al 2006

CYP21A2*126

391G>A; 1683 G>T

 

Disrupted splice donor intron 2; V281L

IVS2 +5 G>A; V281L

SW

 

Friăes et al 2006

CYP21A2*127

962_963insA

478_479insA

I160framenshift

 

SW

 

Janner et al 2006

CYP21A2*128

1353_1354insA

680_681insA

K227frameshift

 

SW

 

Krone et al 2006

CYP21A2*129

2551C>T

1330C>T

R444X

 

SW

 

Krone et al 2006
Loidi et al 2006

CYP21A2*130

2609C>T

1388C>T

P463L

 

SV

2.6%/3.0%

Krone et al 2006
Loidi et al 2006

CYP21A2*131

135_136insC

135_136insC

I46frameshift

 

 

 

Loidi et al 2006

CYP21A2*132

2638_2658duplATGCAGCCTTTCCAAGTGCGG

1417_1437duplATGCAGCCTTTCCAAGTGCGG

M473_R479dup

dup 21 bp E10

SV

 

Loidi et al 2006

CYP21A2*133

1747G>C

905G>C

W302S

 

SV

3%/3%

Loidi et al 2006
Bleicken et al 2008

CYP21A2*134

2007A>G

965A>G

D322G

 

 

18%/27%

Loidi et al 2006
Bleicken et al 2008

CYP21A2*135

113A>T

113A>T

H38L

 

 

 

Tardy et al 2006

CYP21A2*136

2336T>C

1211T>C

F404S

 

SW

 

Baradaran-Heravi et al 2007

CYP21A2*137

2569A>C

1348A>C

T450P

 

SW

 

Baradaran-Heravi et al 2007

CYP21A2*138

19_28delCTGCTGCTGC

19_28delCTGCTGCTGC

L48X

 

CL

 

Baradaran-Heravi et al 2007

CYP21A2*139

1343C>T

670C>T

R224W

 

NC

52%/45.6%

Concolino et al 2007
Concolino et al 2009

CYP21A2*140

65G>A

65G>A

W22X

 

SW

 

Di Pasquale et al 2007

CYP21A2*141

1A>G

1A>G

M1V

 

CL

nd

Tardy et al 2007a

CYP21A2*142

1A>C

1A>C

M1L

 

 

nd

Tardy et al 2007b

CYP21A2*143

175T>A

175T>A

Y59N

 

CL

nd

Tardy et al 2007c

CYP21A2*144

140A>G

140A>G

Y47C

 

 

nd

Tardy et al 2007d

CYP21A2*145

2597C>A

1376C>A

P459H

 

 

nd

Wang et al 2007

CYP21A2*146

1683G>T; 2100T>G 

841G>T;1058T>G

V281L; L353R

 

SW

nd

Abid et al 2008

CYP21A2*147

1636C>T

794C>T

A265V

 

 

92%/100%

Bleicken et al 2008

CYP21A2*148

1778G>A

1219G>A

D407N

 

NC

72.7%/73.6%

Capoluongo et al  2008a
Concolino et al 2009a

CYP21A2*149

734A>G

356A>G

H119R

 

NC

31,6%/31,5%

Capoluongo et al 2008b
Capoluongo et al 2008c
Concolino et al 2009b

CYP21A2*150

1153T>A

581T>A

I194N

 

 

33.2%/46.7%

Capoluongo et al 2008d
Concolino et al 2009b

CYP21A2*151

739A>C

361A>C

K121Q

 

 

14%/19.5%

Riepe et al 2008

CYP21A2*152

166G>A

166G>A

G56R

 

CL

0.7%/1.4%

Soardi et al 2008

CYP21A2*153

696T>G

320T>G

L107R

 

CL

0.4%/0.3%

Soardi et al 2008

CYP21A2*154

803T>C

425T>C

L142P

 

SW

0.4%/0.4%

Soardi et al 2008

CYP21A2*155

185A>T;2578C>T 

185A>T;1357C>T

H62L; P453S

 

SV

4.1%/2.3%

Soardi et al 2008

CYP21A2*156

57G>A

57G>A

W19X

 

 

 

Bidet et al 2009

CYP21A2*157

2599_2616delTCGCTGCAGCCCCTGCCC

1378_1395delTCGCTGCAGCCCCTGCCC

S460_P465del

del 18 bp E10

 

 

Bidet et al 2009

CYP21A2*158

160A>T

160A>T

K54X

 

SW

 

Concolino et al 2009c

CYP21A2*159

298_306dupTGTGGTGGT

201_209dupTGTGGTGGT

61_70 dup

dup 9 bp in E2

CL

 

Dubey et al 2009

CYP21A2*160

707_714delGAGACTAC; 1752G>A

329_336delGAGACTAC;910G>A

G110frameshift; V304M

del8 bp E3+V304M

 

 

Neocleous et al 2009

CYP21A2*161

1683G>T; 1762_1763insT

841G>T; 920_921insT

V281L; L307frameshift

 

SW

 

Neocleous et al 2009

CYP21A2*162

2286C>G

1161C>G

N387K

 

 

 

Wasniewska et al 2009

CYP21A2*163

2516C>T

1295C>T

P432L

 

 

 

Carvalho et al 2010, in press

CYP21A2*164

1588T>C

746T>C

V249A

 

 

 

Concolino et al 2010

CYP21A2*165

772C>T

394C>T

R132C

 

 

 

Minutolo et al 2011

CYP21A2*166

929C>T

445C>T

R149C

 

 

 

Minutolo et al 2011

CYP21A2*167

1689A>G

847A>G

M283V

 

NC

 

Minutolo et al 2011

CYP21A2*168

2007A>G;2452G>A

965A>G;1291G>A

D332G; E431K

 

 

 

Minutolo et al 2011

CYP21A2*169

2509_2010delGG

1409_1410delGG

G470frameshift

 

SW

 

Minutolo et al 2011

CYP21A2*170

984T>C

500T>C

L167P

 

SW

0.7%/0.4%

Tardy et al 2010

CYP21A2*171

1717G>A

875G>A

G292D

 

SW

0.5%/0.7%

Tardy et al 2010

CYP21A2*172

2000G>A

959G>A

E320K

 

CL

4.6%/4.5%

Tardy et al 2010

CYP21A2*173

1371G>A

698G>A

R233K

 

 

15%/8.1%

Tardy et al 2010

CYP21A2*174

1347C>T

1105C>T

R369W

 

NC

45.8%/48.5%

Tardy et al 2010

CYP21A2*175

1362T>C

689T>C

I230T

 

NC

63.1%/70.6%

Tardy et al 2010

CYP21A2*176

1362T>C; 1683G>T

689T>C;841G>T

I230T; V281L

 

NC

9.4%/8.5%

Tardy et al 2010

CYP21A2*177

987C>A

503C>A

T168N

 

NC

 

Vrzalova et al 2010

CYP21A2*178

991C>A

507C>A

S169X

 

SW

 

Vrzalova et al 2010

CYP21A2*179

2596C>T

1375C>T

P459S

 

SV

 

Vrzalova et al 2010

CYP21A2*180

2282C>G

1157C>G

P386R

 

SW

 

Vrzalova et al 2010

CYP21A2*181

2454G>T

1223G>T

R408L

 

CL

 

Yu et al 2010

 

Thanks to Anna Wedell, Michela Barbaro and Svetlana Lajic for their help with the CYP21A2 web page.

Changes made since the last update (13-Nov-2007) are marked in red.

Links to the NCBI dbSNP homepage are available for functional SNPs when present in NCBI's database.

 Footnote:
SW, salt-wasting CAH; SV, simple-virilizing CAH; NC, non-classic CAH.
The phenotype most often associated with an allele is given (when known), although variability occurs in individual cases, especially for partially inactivating mutations. References on mutation frequencies in different populations and genotype-phenotype relationships:
Higashi et al 1991; Mornet et al 1991; Speiser et al 1992; Wedell et al 1994; Ezquieta et al 1995; Wilson et al 1995; Carrera et al 1996; Jääskeläinen et al 1997; Bachega et al 1998; Fardella et al 1998; Ordonez-Sánchez et al 1998; Krone et al 2000; White et al 2000; Dracopoulou-Vabouli et al 2001; Stikkelbroeck et al 2003.

SwissProt OMIM GeneCards

 


Home Page Inclusion criteria
CYP1A1 CYP1A2 CYP1B1 CYP2A6 CYP2A13 CYP2B6 CYP2C8 CYP2C9 CYP2C19 CYP2D6 CYP2E1 CYP2F1 CYP2J2
CYP2R1 CYP2S1 CYP2W1 CYP3A4 CYP3A5 CYP3A7 CYP3A43 CYP4A11 CYP4A22 CYP4B1 CYP4F2 CYP5A1 CYP8A1 CYP19A1 CYP21A2
CYP26A1 POR

This page was updated 21-Mar-2011 by Sarah C Sim
Questions and comments are always welcome